ID: 1007350637_1007350641

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1007350637 1007350641
Species Human (GRCh38) Human (GRCh38)
Location 6:41271155-41271177 6:41271171-41271193
Sequence CCTCTTCACCCTAAATATCACGG ATCACGGATCACCCTACACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 64} {0: 1, 1: 0, 2: 0, 3: 1, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!