ID: 1007430759_1007430765

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1007430759 1007430765
Species Human (GRCh38) Human (GRCh38)
Location 6:41775419-41775441 6:41775444-41775466
Sequence CCTGGCCTGTCTGACATCGGCGG ACTCTCAAAGGAGAAGAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 65} {0: 1, 1: 0, 2: 3, 3: 30, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!