|
Left Crispr |
Right Crispr |
| Crispr ID |
1007566042 |
1007566044 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:42851099-42851121
|
6:42851139-42851161
|
| Sequence |
CCATTGAACTTGGGAGACGGAGG |
CGTGCCACTGCACTCCAGCCTGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 24731, 1: 122279, 2: 204638, 3: 210833, 4: 145962} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|