ID: 1007566042_1007566044

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1007566042 1007566044
Species Human (GRCh38) Human (GRCh38)
Location 6:42851099-42851121 6:42851139-42851161
Sequence CCATTGAACTTGGGAGACGGAGG CGTGCCACTGCACTCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 65, 2: 630, 3: 2026, 4: 3708} {0: 24731, 1: 122279, 2: 204638, 3: 210833, 4: 145962}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!