ID: 1007566042_1007566045

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1007566042 1007566045
Species Human (GRCh38) Human (GRCh38)
Location 6:42851099-42851121 6:42851140-42851162
Sequence CCATTGAACTTGGGAGACGGAGG GTGCCACTGCACTCCAGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 65, 2: 630, 3: 2026, 4: 3708} {0: 52453, 1: 149973, 2: 210600, 3: 182318, 4: 112095}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!