|
Left Crispr |
Right Crispr |
| Crispr ID |
1007566042 |
1007566045 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
6:42851099-42851121
|
6:42851140-42851162
|
| Sequence |
CCATTGAACTTGGGAGACGGAGG |
GTGCCACTGCACTCCAGCCTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 65, 2: 630, 3: 2026, 4: 3708} |
{0: 52453, 1: 149973, 2: 210600, 3: 182318, 4: 112095} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|