ID: 1007581159_1007581169

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1007581159 1007581169
Species Human (GRCh38) Human (GRCh38)
Location 6:42960941-42960963 6:42960973-42960995
Sequence CCAGCGGGTGCTCGACGTAGCCT GGTGAGCCCAGGCCGGGGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 23} {0: 1, 1: 0, 2: 4, 3: 80, 4: 703}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!