ID: 1007603209_1007603218

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1007603209 1007603218
Species Human (GRCh38) Human (GRCh38)
Location 6:43096718-43096740 6:43096753-43096775
Sequence CCTGCGGCTGTGCTGGGCCAGCC CGGTAGGGCCCTGCCTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 346} {0: 1, 1: 0, 2: 2, 3: 13, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!