ID: 1007603214_1007603218

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1007603214 1007603218
Species Human (GRCh38) Human (GRCh38)
Location 6:43096739-43096761 6:43096753-43096775
Sequence CCTGCCTGCCTGTCCGGTAGGGC CGGTAGGGCCCTGCCTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 509} {0: 1, 1: 0, 2: 2, 3: 13, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!