ID: 1007673525_1007673528

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1007673525 1007673528
Species Human (GRCh38) Human (GRCh38)
Location 6:43576155-43576177 6:43576172-43576194
Sequence CCCTTCGCAGCGGGCGCGCTGTC GCTGTCAGACCTCAGTCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 21} {0: 1, 1: 0, 2: 3, 3: 18, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!