ID: 1007888159_1007888165

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1007888159 1007888165
Species Human (GRCh38) Human (GRCh38)
Location 6:45256356-45256378 6:45256382-45256404
Sequence CCTATTCCCCATGAATGATGATT CTGTTTCCTCACATGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!