ID: 1007951741_1007951744

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1007951741 1007951744
Species Human (GRCh38) Human (GRCh38)
Location 6:45878662-45878684 6:45878678-45878700
Sequence CCTGGAGCAGAAGCACACCAAAG ACCAAAGTAGAAAGAGCTAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!