ID: 1007952122_1007952132

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1007952122 1007952132
Species Human (GRCh38) Human (GRCh38)
Location 6:45881807-45881829 6:45881854-45881876
Sequence CCTCTTCAAGTGCAGAAGGTTGT GACCACCAAGGGCATGGGTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!