ID: 1008030408_1008030421

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1008030408 1008030421
Species Human (GRCh38) Human (GRCh38)
Location 6:46688163-46688185 6:46688212-46688234
Sequence CCTCGCTGGCCCTGCGGGTGTCC CCCGGTGCAGCTGTGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 192} {0: 1, 1: 0, 2: 4, 3: 52, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!