ID: 1008030411_1008030426

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1008030411 1008030426
Species Human (GRCh38) Human (GRCh38)
Location 6:46688173-46688195 6:46688226-46688248
Sequence CCTGCGGGTGTCCTTCGTGGACG GGGGGCTGGTGGGCGAGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28} {0: 1, 1: 1, 2: 13, 3: 129, 4: 1576}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!