ID: 1008132586_1008132588

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1008132586 1008132588
Species Human (GRCh38) Human (GRCh38)
Location 6:47735742-47735764 6:47735758-47735780
Sequence CCAACTTCTGGGTATATATCTGA TATCTGAAAAAATTGAAAGTGGG
Strand - +
Off-target summary {0: 4, 1: 46, 2: 285, 3: 1265, 4: 4515} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!