ID: 1008270515_1008270519

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1008270515 1008270519
Species Human (GRCh38) Human (GRCh38)
Location 6:49483728-49483750 6:49483745-49483767
Sequence CCACGCCCACCTGGAACTACAGC TACAGCTGACCTGCAAGCACCGG
Strand - +
Off-target summary {0: 1, 1: 56, 2: 522, 3: 455, 4: 680} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!