ID: 1008286624_1008286632

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1008286624 1008286632
Species Human (GRCh38) Human (GRCh38)
Location 6:49660650-49660672 6:49660677-49660699
Sequence CCCAGGCAGCTTTCCTGAGCCTT CCTGGGTTGTAATGACTCCCAGG
Strand - +
Off-target summary {0: 15, 1: 44, 2: 70, 3: 138, 4: 440} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!