ID: 1008378546_1008378551

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1008378546 1008378551
Species Human (GRCh38) Human (GRCh38)
Location 6:50818901-50818923 6:50818921-50818943
Sequence CCTCCTAGAGACCAGGCTGCCAT CATCATGCTCTGGAAGCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 139} {0: 1, 1: 0, 2: 1, 3: 9, 4: 149}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!