ID: 1008404467_1008404473

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1008404467 1008404473
Species Human (GRCh38) Human (GRCh38)
Location 6:51103346-51103368 6:51103397-51103419
Sequence CCCTCTACCATCAGAGTGAACAG GCAACCTACTCATCTGACAAAGG
Strand - +
Off-target summary No data {0: 6170, 1: 6483, 2: 4919, 3: 7430, 4: 7056}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!