ID: 1008404467_1008404474

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1008404467 1008404474
Species Human (GRCh38) Human (GRCh38)
Location 6:51103346-51103368 6:51103398-51103420
Sequence CCCTCTACCATCAGAGTGAACAG CAACCTACTCATCTGACAAAGGG
Strand - +
Off-target summary No data {0: 7851, 1: 5238, 2: 3887, 3: 3835, 4: 2664}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!