ID: 1008820395_1008820402

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1008820395 1008820402
Species Human (GRCh38) Human (GRCh38)
Location 6:55625124-55625146 6:55625172-55625194
Sequence CCAGCCGTCTTCTGCAGATAACT GGCCTGTTAATGGGCTTTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 165, 3: 176, 4: 265}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!