ID: 1008952492_1008952498

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1008952492 1008952498
Species Human (GRCh38) Human (GRCh38)
Location 6:57175897-57175919 6:57175927-57175949
Sequence CCCCAATTTGAAGCCAGTTGGTC CTGGAGGCCTAGACTTGCAACGG
Strand - +
Off-target summary {0: 2, 1: 31, 2: 85, 3: 216, 4: 453} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!