ID: 1008952493_1008952498

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1008952493 1008952498
Species Human (GRCh38) Human (GRCh38)
Location 6:57175898-57175920 6:57175927-57175949
Sequence CCCAATTTGAAGCCAGTTGGTCA CTGGAGGCCTAGACTTGCAACGG
Strand - +
Off-target summary {0: 3, 1: 36, 2: 134, 3: 235, 4: 490} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!