ID: 1008966987_1008966994

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1008966987 1008966994
Species Human (GRCh38) Human (GRCh38)
Location 6:57322629-57322651 6:57322669-57322691
Sequence CCAGCCCTGGGGAACTGTGAGTC TTTATGGGTTTACTCAGTCTTGG
Strand - +
Off-target summary {0: 5, 1: 251, 2: 3897, 3: 9101, 4: 8936} {0: 1, 1: 0, 2: 2, 3: 14, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!