ID: 1008986302_1008986306

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1008986302 1008986306
Species Human (GRCh38) Human (GRCh38)
Location 6:57547727-57547749 6:57547758-57547780
Sequence CCTTGATGACAGCATGCTTAAGG ATGTTGTTATAATTGGGTCAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 143} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!