ID: 1009369681_1009369687

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1009369681 1009369687
Species Human (GRCh38) Human (GRCh38)
Location 6:62883173-62883195 6:62883215-62883237
Sequence CCAATAATATTGTTCCTAATACC ATTACTCCCAATATCGCAGAAGG
Strand - +
Off-target summary No data {0: 57, 1: 375, 2: 857, 3: 1394, 4: 1723}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!