ID: 1009504765_1009504776

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1009504765 1009504776
Species Human (GRCh38) Human (GRCh38)
Location 6:64463069-64463091 6:64463122-64463144
Sequence CCCAAGCAGCTGGGACTACAGGT TGGATTTTTTTACTAGAGATGGG
Strand - +
Off-target summary {0: 583, 1: 17277, 2: 102488, 3: 246237, 4: 346263} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!