ID: 1009520944_1009520954

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1009520944 1009520954
Species Human (GRCh38) Human (GRCh38)
Location 6:64681587-64681609 6:64681632-64681654
Sequence CCTGGCCTCGCTAAAAGTGATTC GCCTGTAATCCCAACATTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70} {0: 1149, 1: 28422, 2: 260351, 3: 276904, 4: 213210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!