ID: 1009520952_1009520956

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1009520952 1009520956
Species Human (GRCh38) Human (GRCh38)
Location 6:64681614-64681636 6:64681635-64681657
Sequence CCGGGCGCGGTGGCTCAGGCCTG TGTAATCCCAACATTTTGGGAGG
Strand - +
Off-target summary {0: 491, 1: 34132, 2: 89308, 3: 152461, 4: 169741} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!