ID: 1009635774_1009635777

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1009635774 1009635777
Species Human (GRCh38) Human (GRCh38)
Location 6:66262638-66262660 6:66262657-66262679
Sequence CCATAGTTGGTCCAACATTCTGT CTGTGGACCACTAACGAGCAAGG
Strand - +
Off-target summary {0: 27, 1: 41, 2: 36, 3: 21, 4: 124} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!