ID: 1009847497_1009847500

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1009847497 1009847500
Species Human (GRCh38) Human (GRCh38)
Location 6:69151802-69151824 6:69151828-69151850
Sequence CCAAATCTCATCTTTAATTTTAG CTATAGTCCCCATGTGCCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 48, 3: 595, 4: 1814}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!