ID: 1009945869_1009945879

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1009945869 1009945879
Species Human (GRCh38) Human (GRCh38)
Location 6:70341330-70341352 6:70341375-70341397
Sequence CCTTGGGTAGCTCCATCCCTGTG TCCTGGCTGCTTTCATGGGCTGG
Strand - +
Off-target summary No data {0: 350, 1: 579, 2: 976, 3: 1101, 4: 1218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!