ID: 1009969525_1009969537

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1009969525 1009969537
Species Human (GRCh38) Human (GRCh38)
Location 6:70612304-70612326 6:70612326-70612348
Sequence CCCCCTACCCACCTCCACACCAC CCCCCTCTGCAGTCGGTCAAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!