ID: 1009988155_1009988168

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1009988155 1009988168
Species Human (GRCh38) Human (GRCh38)
Location 6:70806476-70806498 6:70806523-70806545
Sequence CCGCCCTCCTTCAGCTCACCCTC CAGTCCCAGTGAGATGAACCAGG
Strand - +
Off-target summary {0: 3, 1: 166, 2: 451, 3: 822, 4: 1617} {0: 320, 1: 800, 2: 1270, 3: 925, 4: 1105}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!