ID: 1010042174_1010042178

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1010042174 1010042178
Species Human (GRCh38) Human (GRCh38)
Location 6:71397786-71397808 6:71397807-71397829
Sequence CCTCCTCATGACTTCTGTCTCAG AGGACAAAGAAGGAGCCCATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!