ID: 1010082361_1010082367

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1010082361 1010082367
Species Human (GRCh38) Human (GRCh38)
Location 6:71878745-71878767 6:71878760-71878782
Sequence CCTGTAATCCCGGTACTTTGAAA CTTTGAAAGGCCAAGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 53, 2: 1814, 3: 35805, 4: 341991} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!