ID: 1010213299_1010213304

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1010213299 1010213304
Species Human (GRCh38) Human (GRCh38)
Location 6:73379792-73379814 6:73379836-73379858
Sequence CCTGGTCTTAAACTCCAGAGCTC CTTCCAACTCTGAAAGTGCTGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 215, 3: 2167, 4: 3642} {0: 1, 1: 0, 2: 16, 3: 359, 4: 4554}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!