ID: 1010644800_1010644807

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1010644800 1010644807
Species Human (GRCh38) Human (GRCh38)
Location 6:78373747-78373769 6:78373785-78373807
Sequence CCTCCATGGGTTGGTGGTAGTGG GCTCCTCTGCTTGTGGAAAGAGG
Strand - +
Off-target summary No data {0: 9, 1: 76, 2: 265, 3: 395, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!