ID: 1010775968_1010775972

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1010775968 1010775972
Species Human (GRCh38) Human (GRCh38)
Location 6:79886200-79886222 6:79886216-79886238
Sequence CCACAATCACAGGCAACCAAAGC CCAAAGCAAATATGGGCAAATGG
Strand - +
Off-target summary {0: 6, 1: 368, 2: 737, 3: 1111, 4: 2060} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!