ID: 1010865952_1010865959

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1010865952 1010865959
Species Human (GRCh38) Human (GRCh38)
Location 6:80976976-80976998 6:80977004-80977026
Sequence CCCCTCAATTTGCATTGACCTGC ACTATGGATGTACTTGAAAGTGG
Strand - +
Off-target summary {0: 3, 1: 4, 2: 17, 3: 41, 4: 139} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!