ID: 1010958389_1010958395

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1010958389 1010958395
Species Human (GRCh38) Human (GRCh38)
Location 6:82117718-82117740 6:82117766-82117788
Sequence CCTGAAGTCCAAAGTCCTCCTGA TATTGTTGAAGCCAAGGTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!