ID: 1011022851_1011022859

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1011022851 1011022859
Species Human (GRCh38) Human (GRCh38)
Location 6:82833598-82833620 6:82833646-82833668
Sequence CCCAAAGTTAGCTTGGCCTACAC CTGTGAGACTAGCAGCAAGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!