ID: 1011326346_1011326353

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1011326346 1011326353
Species Human (GRCh38) Human (GRCh38)
Location 6:86152740-86152762 6:86152793-86152815
Sequence CCACTCATGTGTTCCTCAGAATG TCTCAGGTTTCTATAGGCCCAGG
Strand - +
Off-target summary No data {0: 2, 1: 16, 2: 42, 3: 104, 4: 266}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!