ID: 1011640446_1011640454

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1011640446 1011640454
Species Human (GRCh38) Human (GRCh38)
Location 6:89412200-89412222 6:89412216-89412238
Sequence CCGCCCCGCCCGCCGGCGGAGGA CGGAGGAGTCAGCCGGAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 235} {0: 1, 1: 0, 2: 1, 3: 9, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!