ID: 1011652173_1011652180

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1011652173 1011652180
Species Human (GRCh38) Human (GRCh38)
Location 6:89516597-89516619 6:89516646-89516668
Sequence CCTGCAAGTATCTGGGTTTACAG TTTGTATTTTTAGTAGAGACGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 73, 3: 1538, 4: 5362} {0: 164005, 1: 210050, 2: 126715, 3: 67031, 4: 60843}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!