ID: 1011687415_1011687425

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1011687415 1011687425
Species Human (GRCh38) Human (GRCh38)
Location 6:89834713-89834735 6:89834764-89834786
Sequence CCACTGCGCCTGGCCTCAAAATT CACTGAAGGGCTTTTTGGTGGGG
Strand - +
Off-target summary {0: 1, 1: 51, 2: 464, 3: 2794, 4: 10897} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!