ID: 1011687419_1011687422

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1011687419 1011687422
Species Human (GRCh38) Human (GRCh38)
Location 6:89834746-89834768 6:89834759-89834781
Sequence CCTGAAATCAGCAGGAAGCACTG GGAAGCACTGAAGGGCTTTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 343} {0: 1, 1: 0, 2: 1, 3: 25, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!