ID: 1012586569_1012586575

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1012586569 1012586575
Species Human (GRCh38) Human (GRCh38)
Location 6:100930486-100930508 6:100930535-100930557
Sequence CCACATGTATGTCTTCTTTTGAA CTTTTTAATGGGATTTTGGTTGG
Strand - +
Off-target summary {0: 440, 1: 1028, 2: 1915, 3: 5291, 4: 6674} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!