ID: 1012651221_1012651223

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1012651221 1012651223
Species Human (GRCh38) Human (GRCh38)
Location 6:101755526-101755548 6:101755560-101755582
Sequence CCTAGTCTAGACTCTAGAGAGTT TTTTCCTCATGGAGATATAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 93} {0: 1, 1: 0, 2: 1, 3: 18, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!