ID: 1012960209_1012960214

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1012960209 1012960214
Species Human (GRCh38) Human (GRCh38)
Location 6:105614476-105614498 6:105614520-105614542
Sequence CCTTTAATGTTTCTAGATCTCTT TTTTGCATCTTTGTCTTGGAAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 35, 4: 368}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!