ID: 1013292922_1013292927

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1013292922 1013292927
Species Human (GRCh38) Human (GRCh38)
Location 6:108734069-108734091 6:108734106-108734128
Sequence CCTGGAGACTTGTGCAATCACAG CCCAGAGTTTCTGATTCTGCAGG
Strand - +
Off-target summary No data {0: 9, 1: 44, 2: 244, 3: 709, 4: 1405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!